Decoding IG1 - Solution

Puzzle Location: The DNA Lounge

This puzzle is solved in two major phases. The first is to translate the IG1 gene. The second is to manipulate the solution again to produce a location. The first step in translating the IG1 gene is to determine what the nucleotide sequence is. Each chunk of the gene is shown on the front of a plot card.

Each blue column represents a single nucleotide base. Each column also has one of four possible positions highlighted. The trick is to determine which position corresponds to what base (A, G, T, or C).

The assignment of vertical position within a column to a nucleotide can be determined from the concert announcment poster on the front door of the nightclub.

Taking the first letters of the words in the name of the band, in the vertical order they appear on the poster, gives T (top), G, A, C (bottom).

Each card can then be translated into a set of nucleotide sequences, which will then be translated into single-letter amino acid sequences. For this translation to make any sense, however, the cards need to be put into a specific order. This is done by looking at the translated letters and trying to make words (a rather time-consuming process). The proper order of the cards is:

Card     Location     Sequence     Translation 3     Tiburon Ferry     ATGGAGAGGGAAC     MERE + 1/3 L 4     Angel Island     TCATCGTAATAAA     2/3 L + IVI + 2/3 N 5     UCB Tunnel     TGGTACCCACAT     1/3 N + GTH + 2/3 I 19     Fort Point     AAACGGCTCATG     1/3 I + NGS + 2/3 W 6     Emeryville     GATTCTACTCGC     1/3 W + ILL + 2/3 A 2     KPIX     GCTGTGGGCTTA     1/3 A + LWA + 2/3 Y 20     AIDS Memorial Grove     TTCTTTCATTA     1/3 Y + SFI + 1/3 N 1     Heron's Head Park     ACGACACCCATG     2/3 N + DTH + 1/3 E 18     Cows on Hill     AAATCAGATTCA     2/3 E + IRF + 1/3 I 7     Transtime, Inc.     TCAACATAAGTCA     2/3 I + NIS + 2/3 H 17     Wind Harp     CTACGAAACACTGA     1/3 H + YETL + 1/3 I 16     Skyline College Overlook     TTTTCGAAAG     2/3 I + FE + 2/3 S 8     KGO Towers     CGAAAACGACCT     1/3 S + END + 2/3 L 15     Mountain House     CGAATCATCCGT     1/3 L + ESS + 2/3 V 14     Woodside Town Hall     CGCCCGGATAGA     1/3 V + ARI + 2/3 E 9     Affymetrix     AACATATTGGA     1/3 E + TYW + 1/3 I 10     San Jose Tech Museum     TTCTCCTGAACGA     2/3 I + LLN + 2/3 E 13     Stevens Creek at Stevens Creek     GGTTGAAAGAGA     1/3 E + VER + 2/3 D 12     9 & 35     CATCATGATCAA     1/3 D + IMI + 2/3 N 11     Lakeside School     CATCAGCCACTAG     1/3 N + ISH*

The overall translation is thus:

M  E  R  E  L  I  V  I  N  G  T  H  I  N  G  S  W  I  L  L  A  L  W  A ATGGAGAGGGAACTCATCGTAATAAATGGTACCCACATAAACGGCTCATGGATTCTACTCGCGCTGTGGGCT   Y  S  F  I  N  D  T  H  E  I  R  F  I  N  I  S  H  Y  E  T  L  I  F  E TATTCTTTCATTAACGACACCCATGAAATCAGATTCATCAACATAAGTCACTACGAAACACTGATTTTCGAA   S  E  N  D  L  E  S  S  V  A  R  I  E  T  Y  W  I  L  L  N  E  V  E  R AGCGAAAACGACCTCGAATCATCCGTCGCCCGGATAGAAACATATTGGATTCTCCTGAACGAGGTTGAAAGA   D  I  M  I  N  I  S  H  * GACATCATGATCAACATCAGCCACTAG

or "Mere living things will always find their finish, yet life's endless variety will never diminish." Huge props to Gordon Dow for generating this phrase, since it had to be topical, start with the letter M, and not use the letters B, J, O, U, X, or Z. Reaching this translation of IG1 is the first step in the solution of the metapuzzle. The second step requires manipulating this translation in order to generate a location. This is done using the security camera photos. The first step is to put the photos into the correct chronological order:

William Genter is sitting alone in his office, looking dejected. Carl Pauling comes in and tells Genter about his grand idea. Pauling gets out a map and discusses it with Genter. Pauling shows Genter where the semaphore flags should be. Genter suggests a location for the caution tape puzzle. Pauling places a small rubber ducky on the map. Pauling discusses the cow-patterned cloth with Genter. Genter and Pauling shake hands, happy with their plan to trick the teams entering the Genodix Job Fair into decoding IG1 for them.

Concatenating the letters in the lower right corner gives: SHIFT IG1. Concatenating the letters at the lower left provides the key by which the IG1 translation should be shifted.

MERELIVINGTHINGSWILLALWAYSFINDTHEIRFINISHYETLIFESENDLESSVARIETYWILLNEVERDIMINISH + FDFCIEHIQWYAOFXLQKVGSFHDUBWJRIOKNZWHSMPJSNKAGXYILIFAQCOHPKMEOKSIICAFCIIWNKUJFVWK ----------------------------------------------------------------------------------   SIXHUNDREDSIXTEENTHSTREETUCSFMISSIONBAYCAMPUSGENENTECHHALLENTERFROMTHENORTHSTEPS

This provides the final solution to the puzzle: 600 16th Street, UCSF Mission Bay Campus, Genentech Hall, enter from the north steps.